BioPythonUtils
BioPython utilities for Sublime Text 3
Details
Installs
- Total 2K
- Win 1K
- Mac 463
- Linux 500
Feb 28 | Feb 27 | Feb 26 | Feb 25 | Feb 24 | Feb 23 | Feb 22 | Feb 21 | Feb 20 | Feb 19 | Feb 18 | Feb 17 | Feb 16 | Feb 15 | Feb 14 | Feb 13 | Feb 12 | Feb 11 | Feb 10 | Feb 9 | Feb 8 | Feb 7 | Feb 6 | Feb 5 | Feb 4 | Feb 3 | Feb 2 | Feb 1 | Jan 31 | Jan 30 | Jan 29 | Jan 28 | Jan 27 | Jan 26 | Jan 25 | Jan 24 | Jan 23 | Jan 22 | Jan 21 | Jan 20 | Jan 19 | Jan 18 | Jan 17 | Jan 16 | Jan 15 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Windows | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
Mac | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Linux | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Readme
- Source
- raw.githubusercontent.com
BioPythonUtils
BioPython Utilities for Sublime Text 3.
Install
Install BioPythonUtils using Package Control. If you don't have Package Control see https://sublime.wbond.net.
The BioPython 1.68 code is bundled with this package, you do not need to install it.
Configure
Add your email address and BLAST defaults to your Settings file.
{
"email_for_eutils": "bio@bioteam.net",
"entrez_retmax": 1000,
"remote_blast_app": "blastp",
"remote_blast_db": "nr",
"remote_blast_format": "Text"
}
The email address is required if you want to download from NCBI using EUtils.
Commands
First select the relevant text, then run a command in the Tools -> BioPythonUtils menu.
- “Translate”
- “Get Sequences by Search”
- “Get Sequences by Id”
- “Get Sequences by Taxon”
- “Remote BLAST”
- “Genbank To Fasta”
“Translate”
Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example: ~~~~
2 atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc 1 atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
or:
atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg
Translation starts at the first codon and continues to the last, regardless of stop codons.
#### "Get Sequences by Search"
Queries [NCBI Nucleotide](https://www.ncbi.nlm.nih.gov/nucleotide/) using [Entrez](https://www.ncbi.nlm.nih.gov/books/NBK184582/)
search service and the selected text and downloads the sequence results in GenBank format.
For example:
human[ORGN] AND AKT1[GENE]
The default maximum number of records downloaded is 20, if you want more than 20 set
the value in your "Settings - User" file ("entrez_retmax").
#### "Get Sequences by Id"
Downloads sequence from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected ids. Ids can be delimited by commas,
returns, or space. For example:
KC781785 2
or:
2 KC781786
or:
284218, 203807
#### "Get Sequences by Taxon"
Downloads a taxon as GenBank format entries from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected
[NCBI Taxonomy](http://www.ncbi.nlm.nih.gov/taxonomy) ids. Ids can be delimited by commas, returns, or space.
#### "Remote BLAST"
Sends the selected Fasta format or "plain" sequence(s) to the [BLAST server at NCBI](http://blast.ncbi.nlm.nih.gov/Blast.cgi) and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application.
#### "Genbank To Fasta"
Creates Fasta format records from the selection, 1 or more GenBank format records.
### Issues
The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is
unusable while the queries ("Get Sequences*", "Remote BLAST") are running.