BioPythonUtils
BioPython utilities for Sublime Text 3
Details
Installs
- Total 2K
- Win 1K
- Mac 462
- Linux 497
| Dec 30 | Dec 29 | Dec 28 | Dec 27 | Dec 26 | Dec 25 | Dec 24 | Dec 23 | Dec 22 | Dec 21 | Dec 20 | Dec 19 | Dec 18 | Dec 17 | Dec 16 | Dec 15 | Dec 14 | Dec 13 | Dec 12 | Dec 11 | Dec 10 | Dec 9 | Dec 8 | Dec 7 | Dec 6 | Dec 5 | Dec 4 | Dec 3 | Dec 2 | Dec 1 | Nov 30 | Nov 29 | Nov 28 | Nov 27 | Nov 26 | Nov 25 | Nov 24 | Nov 23 | Nov 22 | Nov 21 | Nov 20 | Nov 19 | Nov 18 | Nov 17 | Nov 16 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Windows | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 |
| Mac | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Linux | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
Readme
- Source
- raw.githubusercontent.com
BioPythonUtils
BioPython Utilities for Sublime Text 3.
Install
Install BioPythonUtils using Package Control. If you don't have Package Control see https://sublime.wbond.net.
The BioPython 1.68 code is bundled with this package, you do not need to install it.
Configure
Add your email address and BLAST defaults to your Settings file.
{
"email_for_eutils": "bio@bioteam.net",
"entrez_retmax": 1000,
"remote_blast_app": "blastp",
"remote_blast_db": "nr",
"remote_blast_format": "Text"
}
The email address is required if you want to download from NCBI using EUtils.
Commands
First select the relevant text, then run a command in the Tools -> BioPythonUtils menu.
- “Translate”
- “Get Sequences by Search”
- “Get Sequences by Id”
- “Get Sequences by Taxon”
- “Remote BLAST”
- “Genbank To Fasta”
“Translate”
Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example: ~~~~
2 atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc 1 atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
or:
atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg
Translation starts at the first codon and continues to the last, regardless of stop codons.
#### "Get Sequences by Search"
Queries [NCBI Nucleotide](https://www.ncbi.nlm.nih.gov/nucleotide/) using [Entrez](https://www.ncbi.nlm.nih.gov/books/NBK184582/)
search service and the selected text and downloads the sequence results in GenBank format.
For example:
human[ORGN] AND AKT1[GENE]
The default maximum number of records downloaded is 20, if you want more than 20 set
the value in your "Settings - User" file ("entrez_retmax").
#### "Get Sequences by Id"
Downloads sequence from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected ids. Ids can be delimited by commas,
returns, or space. For example:
KC781785 2
or:
2 KC781786
or:
284218, 203807
#### "Get Sequences by Taxon"
Downloads a taxon as GenBank format entries from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected
[NCBI Taxonomy](http://www.ncbi.nlm.nih.gov/taxonomy) ids. Ids can be delimited by commas, returns, or space.
#### "Remote BLAST"
Sends the selected Fasta format or "plain" sequence(s) to the [BLAST server at NCBI](http://blast.ncbi.nlm.nih.gov/Blast.cgi) and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application.
#### "Genbank To Fasta"
Creates Fasta format records from the selection, 1 or more GenBank format records.
### Issues
The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is
unusable while the queries ("Get Sequences*", "Remote BLAST") are running.