ctrl+shift+p filters: :st2 :st3 :win :osx :linux
Browse

Bio​Python​Utils

by bosborne ST3

BioPython utilities for Sublime Text 3

Details

  • 2017.12.18.15.00.45
  • github.​com
  • github.​com
  • 9 years ago
  • 4 hours ago
  • 12 years ago

Installs

  • Total 2K
  • Win 1K
  • Mac 474
  • Linux 517
Aug 11 Aug 10 Aug 9 Aug 8 Aug 7 Aug 6 Aug 5 Aug 4 Aug 3 Aug 2 Aug 1 Jul 31 Jul 30 Jul 29 Jul 28 Jul 27 Jul 26 Jul 25 Jul 24 Jul 23 Jul 22 Jul 21 Jul 20 Jul 19 Jul 18 Jul 17 Jul 16 Jul 15 Jul 14 Jul 13 Jul 12 Jul 11 Jul 10 Jul 9 Jul 8 Jul 7 Jul 6 Jul 5 Jul 4 Jul 3 Jul 2 Jul 1 Jun 30 Jun 29 Jun 28
Windows 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Mac 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Linux 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0

Readme

Source
raw.​githubusercontent.​com

BioPythonUtils

BioPython Utilities for Sublime Text 3.

Install

Install BioPythonUtils using Package Control. If you don't have Package Control see https://sublime.wbond.net.

The BioPython 1.68 code is bundled with this package, you do not need to install it.

Configure

Add your email address and BLAST defaults to your Settings file.

{
    "email_for_eutils": "bio@bioteam.net",
    "entrez_retmax": 1000,
    "remote_blast_app": "blastp",
    "remote_blast_db": "nr",
    "remote_blast_format": "Text"
}

The email address is required if you want to download from NCBI using EUtils.

Commands

First select the relevant text, then run a command in the Tools -> BioPythonUtils menu.

  • “Translate”
  • “Get Sequences by Search”
  • “Get Sequences by Id”
  • “Get Sequences by Taxon”
  • “Remote BLAST”
  • “Genbank To Fasta”

“Translate”

Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example: ~~~~

2 atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc 1 atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc

or:

atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc

atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg

Translation starts at the first codon and continues to the last, regardless of stop codons.

#### "Get Sequences by Search"

Queries [NCBI Nucleotide](https://www.ncbi.nlm.nih.gov/nucleotide/) using [Entrez](https://www.ncbi.nlm.nih.gov/books/NBK184582/)
search service and the selected text and downloads the sequence results in GenBank format.
For example:

human[ORGN] AND AKT1[GENE]

The default maximum number of records downloaded is 20, if you want more than 20 set
the value in your "Settings - User" file ("entrez_retmax").

#### "Get Sequences by Id"

Downloads sequence from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected ids. Ids can be delimited by commas,
returns, or space. For example:

KC781785 2

or:

2 KC781786

or:

284218, 203807

#### "Get Sequences by Taxon"

Downloads a taxon as GenBank format entries from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected
[NCBI Taxonomy](http://www.ncbi.nlm.nih.gov/taxonomy) ids. Ids can be delimited by commas, returns, or space.

#### "Remote BLAST"

Sends the selected Fasta format or "plain" sequence(s) to the [BLAST server at NCBI](http://blast.ncbi.nlm.nih.gov/Blast.cgi) and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application.

#### "Genbank To Fasta"

Creates Fasta format records from the selection, 1 or more GenBank format records.

### Issues

The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is
unusable while the queries ("Get Sequences*", "Remote BLAST") are running.