BioPythonUtils
BioPython utilities for Sublime Text 3
Details
Installs
- Total 2K
- Win 1K
- Mac 468
- Linux 502
Jul 5 | Jul 4 | Jul 3 | Jul 2 | Jul 1 | Jun 30 | Jun 29 | Jun 28 | Jun 27 | Jun 26 | Jun 25 | Jun 24 | Jun 23 | Jun 22 | Jun 21 | Jun 20 | Jun 19 | Jun 18 | Jun 17 | Jun 16 | Jun 15 | Jun 14 | Jun 13 | Jun 12 | Jun 11 | Jun 10 | Jun 9 | Jun 8 | Jun 7 | Jun 6 | Jun 5 | Jun 4 | Jun 3 | Jun 2 | Jun 1 | May 31 | May 30 | May 29 | May 28 | May 27 | May 26 | May 25 | May 24 | May 23 | May 22 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Windows | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Mac | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Linux | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Readme
- Source
- raw.githubusercontent.com
BioPythonUtils
BioPython Utilities for Sublime Text 3.
Install
Install BioPythonUtils using Package Control. If you don't have Package Control see https://sublime.wbond.net.
The BioPython 1.68 code is bundled with this package, you do not need to install it.
Configure
Add your email address and BLAST defaults to your Settings file.
{
"email_for_eutils": "bio@bioteam.net",
"entrez_retmax": 1000,
"remote_blast_app": "blastp",
"remote_blast_db": "nr",
"remote_blast_format": "Text"
}
The email address is required if you want to download from NCBI using EUtils.
Commands
First select the relevant text, then run a command in the Tools -> BioPythonUtils menu.
- “Translate”
- “Get Sequences by Search”
- “Get Sequences by Id”
- “Get Sequences by Taxon”
- “Remote BLAST”
- “Genbank To Fasta”
“Translate”
Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example: ~~~~
2 atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc 1 atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
or:
atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg
Translation starts at the first codon and continues to the last, regardless of stop codons.
#### "Get Sequences by Search"
Queries [NCBI Nucleotide](https://www.ncbi.nlm.nih.gov/nucleotide/) using [Entrez](https://www.ncbi.nlm.nih.gov/books/NBK184582/)
search service and the selected text and downloads the sequence results in GenBank format.
For example:
human[ORGN] AND AKT1[GENE]
The default maximum number of records downloaded is 20, if you want more than 20 set
the value in your "Settings - User" file ("entrez_retmax").
#### "Get Sequences by Id"
Downloads sequence from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected ids. Ids can be delimited by commas,
returns, or space. For example:
KC781785 2
or:
2 KC781786
or:
284218, 203807
#### "Get Sequences by Taxon"
Downloads a taxon as GenBank format entries from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected
[NCBI Taxonomy](http://www.ncbi.nlm.nih.gov/taxonomy) ids. Ids can be delimited by commas, returns, or space.
#### "Remote BLAST"
Sends the selected Fasta format or "plain" sequence(s) to the [BLAST server at NCBI](http://blast.ncbi.nlm.nih.gov/Blast.cgi) and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application.
#### "Genbank To Fasta"
Creates Fasta format records from the selection, 1 or more GenBank format records.
### Issues
The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is
unusable while the queries ("Get Sequences*", "Remote BLAST") are running.